lilcory
lilcory lilcory
  • 03-03-2017
  • History
contestada

what help spread religion during the 1950s

Respuesta :

ethannieweg ethannieweg
  • 03-03-2017
door to door preists helped a bit then
Answer Link
QuangPhu
QuangPhu QuangPhu
  • 03-03-2017
Don't worry here is the best answer

The answer is Television

The phenomena was commonly known as Televangelism. Religious Broadcasting Network such as The God Channel  and Trinity Broadcasting network were really popular back then

Some Televangelist even a regular pastor who did it in their place of worship.
Answer Link

Otras preguntas

What major events led to the establishment of the navy and the department of the navy?
How did the Hellenistic kings spread Greek culture
Give two reasons that older adults face a greater risk of vitamin d deficiency than younger people?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Paula begins to notice there are patterns to where people sit on the bus, and that these patterns differ depending on whether the rider is male or female. based
Helppppp how do u do this????
can someone help me please
At age 76 years, which chronic condition is elizabeth most likely to have?
PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M
Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho