StephonA180165 StephonA180165
  • 03-11-2022
  • Physics
contestada

The neutrons within the nucleus of an atom have what charge?Question 15 options:negativesame as an electronsame as a protonno charge

Respuesta :

EmeryL271903 EmeryL271903
  • 03-11-2022

The nuclues of an atom contains the proton and the nuetron. The proton is positively charged while the nuetron has no charge.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
what rule does static electricity follow
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s