Apoller Apoller
  • 03-09-2022
  • Mathematics
contestada

16•(-4)=
Answer what like by hand

Respuesta :

DanielEgert
DanielEgert DanielEgert
  • 03-09-2022

Answer:

-64

Step-by-step explanation:

4 times 10=40

+4times 6=24

=64

Times by -1

=-64

Answer Link
morgan587262 morgan587262
  • 03-09-2022
-64 going to be your correct answer.
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
2sinx+1 = 0 help me :v
Solve by using Substitution, please help! Show work if you can!
Determine the value of y, if x is -2. Y=|x|-8
You bike 5 1/2 miles from your house to a state park. You travel 1/2 of that distance in the woods. You bike along a bank of a stream for the last 1/2 of the wo
solve the inequality -7/2(12x+6)<8-5x help please ​
managers for isabella’s icy treats, a business that operates two dozen ice cream trucks in a large city, have implemented an excellent strategy. now the manager
12. What are 3 ways you could write the ratio for 3 doughnuts to 4 cups of coffee?
Question 3 of 5 Based on the timeline, which world monument was built first? Construction of World Monuments Pyramids at Giza Parthenon Colosseum Chichen Itza A
what happens in scene 4 because of an event in scene 3? parts of play