frankieram00710 frankieram00710
  • 02-03-2022
  • Mathematics
contestada

help me. I need help please

help me I need help please class=

Respuesta :

Cevan2985 Cevan2985
  • 02-03-2022
The answer is 59
Hope it helps
Answer Link

Otras preguntas

What is the value of x?
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.
What brings the u.s. into this war? - 1. economic factors (natural resources and new markets 2. nationalistic factors (competition to create an empire/prove you
Your religious identity is only important for you within your family and does not matter in the public sphere.
Is the interaction that occurs among elements of the department of defense engaged us government?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis
2x + 3y = 144x + 6y = 28 Which statement about the pair of equations is true?