michelerin3755 michelerin3755

02-02-2022
Chemistry

contestada

Raquel has collected $3. 80 in nickels and dimes. She has exactly 48 nickels. How many dimes does she have?.

Respuesta :

slonetrace slonetrace

02-02-2022

Answer:

14 dimes

Explanation:

48 nickels = 48 x .05 = $2.40

$3.80 - $2.40 = $ 1.40

$1.40 / .10 = 14 dimes

Answer Link

Otras preguntas

A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2

The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration

Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm

Please someone help me with this

The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

N the world's lowest-income nations, two in ten children born die by the age of

How did the Bataan Death March gets its name

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.