12580159 12580159
  • 02-01-2022
  • Mathematics
contestada

Three numbers are represented by 3x-5, 5x-6, 4x+11. Find the mean in terms of x.

please help

Respuesta :

jamesren64 jamesren64
  • 02-01-2022

Answer:

4x

Step-by-step explanation:

Mean is the average of the numbers. So add the terms and then divide by 3.

Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
Why was wilson not able to finish his speaking tour
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
How to change 3 7/8 into an improper fraction
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5