ocdzain ocdzain
  • 02-01-2022
  • Mathematics
contestada

find the value of x write your final answer as x=...

find the value of x write your final answer as x class=

Respuesta :

jcherry99
jcherry99 jcherry99
  • 02-01-2022

Answer:

Step-by-step explanation:

The small square represents a 90 degree angle. So you know 1 angle

5x + 4x + 90 = 360 because you have a circle in the center. Combine left.

9x + 90 = 360         Subtract 90 from both sides

9x = 360 - 90          Combine

9x = 270                  Divide by 9

x = 270/9

x = 30

Answer Link

Otras preguntas

How much money, in dollars, does one mole of nickels represent?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
What would be the most likely effect of one company buying a competitor?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
A light bulb converts electrical energy into electromagnetic energy is true or false?
Is 5/7 greater than 4/6
Why were the committees of correspondence powerful?