G30409 G30409
  • 02-12-2021
  • Mathematics
contestada

Why are Marcel's and Stephanie's taxable incomes less than their annual salaries?

Respuesta :

francocanacari
francocanacari francocanacari
  • 07-12-2021

Marcel's and Stephanie's taxable incomes are less than their annual salaries because they both have a series of tax deductions that favor them when it comes to paying taxes.

A deductible item therefore reduces the income on which payment is made, in the case of profit tax (such as corporate income tax) the profit of a company on which payment is made.

Learn more about tax deductions in https://brainly.com/question/20120691

Answer Link

Otras preguntas

The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which system of government would states function independently of each other?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Write expression using the distributive property to find the product of 7 times 63
how do i find the angles on a kite?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
The Panama Canal connects what two bodies of water?