sashamanger4028 sashamanger4028
  • 01-10-2021
  • Biology
contestada

What makes an unsaturated fat different from a saturated fat, check all the apply

Respuesta :

aidenadams96
aidenadams96 aidenadams96
  • 01-10-2021

Answer:

Unsaturated fast is a type of fat containing a high proportion of fatty acid molecules with at least one double bond, considered to be healthier in the diet than saturated fat. And Saturated fat is a type of fat containing fatty acid chains that have only single bonds, and considered not healthy if consumed much of

Explanation:

Answer Link

Otras preguntas

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
How well did feudalism establish order in the Middle ages?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
when Jefferson took office he did what
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Which body tissue or organ contains the most mitochondria?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12