Sjekdkdndn
Sjekdkdndn Sjekdkdndn
  • 01-10-2021
  • Mathematics
contestada

amazing facts for kids​

Respuesta :

Bora77
Bora77 Bora77
  • 01-10-2021

Answer:

Elephants are the only animals that cannot jump.

the strongest muscle in the body is the tongue.

the name of all the continents end with the same letter that they start.

Answer Link

Otras preguntas

How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?
a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used In one serving
What is one key difference between the radiation and convection zones?
__________ is a good example of congressional casework. analysis of an incumbent's policy positions prior to a debate analysis of water quality within a distric
A right triangle height of 10cm and a hypotenuse of 26cm what is the b
(8n+1)(6n-3) please solve in quadratic formula
PLEASE HELP ME !!!!                 Use I = PRT to solvEI = $350 P= $700                     Find T (TIME IN YEARS) R= 10% (
Define the principles of self boundaries and explain how it impacts medical assisting
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the missing length indicated