sierrarenea32 sierrarenea32

01-12-2016
Biology

contestada

Which organ contains alveoli?
A) gills
B) lungs
C) neither gills nor lungs
D) both gills and lungs

Respuesta :

Аноним Аноним

01-12-2016

D both bills and lungs

Answer Link

Otras preguntas

The non-proliferation treaty attempts to prevent the spread of __________ weapons.

Explain the carbon cycle and explain why burning fossil fuels is an issue.

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If o- can give to every other blood type, why cant it recieve other blood types

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol

The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u

When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61