pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

What is an ecosystem
prioritizes her own goals rather than the teams goals
Rewrite ×3×3×33 using an exponent
Kendall bought 4 1/5 pounds of chicken she cooked one third of it how many pounds of chicken are uncooked
How long does it take to get the stomach flu after exposure?
Cindy is using division to write a fraction equivalent to 30-100.She tried to divide the numerator and denominator by 3.She got stuck.What advice would you give
what are two reasons that people in the colonies stayed loyal to britain
Carla's boyfriend plays the guitar. plays at all parties.
Which of the following is an accurate statement about the Navigation Acts?
Do the benefits of exploring mars outweigh the risks?