pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

What is the solution to the system of linear equations A. (-3,0) B. (-3,3) C. (0,2) D. (3,1)
waht is Fiscal period
how to divied and multiply fraction but in word problems
The vertices of rectangle HJKL are listed below. H(-3,2) J(-2,1) K(-5,2) L(-6,-1) What is the approximate perimeter of rectangle HJKL?
What is the range of these numbers? 8,4,9,2,3
It cost $3.99 for 25 fl. oz. of detergent or $6.99 for 90 fl. oz. Which is a better buy?
Countries such as Canada that belong to the commonwealth of Nation's have ties with Great Britain because
Plate tectonics suggests that the_____ floats and moves on the _______
Help please ASAP!!!!!!
what are 2 things that lyddie appreciates about living in a boarding house