froggies805
froggies805 froggies805
  • 01-04-2021
  • Mathematics
contestada

help me plzzzzzzzzzzzzzzzzzzz

help me plzzzzzzzzzzzzzzzzzzz class=

Respuesta :

hloving0180
hloving0180 hloving0180
  • 01-04-2021

Answer:

-5

Step-by-step explanation:

1*1=1

1-6= -5

Hope this helped!

Answer Link

Otras preguntas

How many times larger is 6 × 1011 than 2 × 10-5? A. 3 × 1016 B. 3 × 1055 C. 3 × 10-55 D. 3 × 10-16
The United States is an example of what type of government?
Latitude measures ________________ distances, and longitude measures __________________________ distances.
Find the area of the circle. 18 ft A 1017.9 ft2 B 254.5 ft? С 113.1 ft2 D 339.3 ft2
What effect does the structure of events have on the reader? How would the effect change if the negative outcomes had been avoided?
Weave mat originated from? ​
What possible reasons could be given for the development of prejudice?
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
A ball reaches a speed of 28.05 cm per second and travels 1011 cm. How many seconds was the ball moving? Explain your answer. ​
In the text, the author describes how Rome’s rostra were used to address the public. How do people go about addressing the public today? How does public speakin