Sapdix
Sapdix Sapdix
  • 04-03-2021
  • Mathematics
contestada

Simplify 4g-6h-5g-3g+10h+6g​

Respuesta :

Аноним Аноним
  • 04-03-2021

Answer:

2g + 4h

Step-by-step explanation:

[tex]\text{Combine Like Terms.}\\\\\\4g-6h-5g-3g+10h+6g\\\\4g-5g-3g+6g -6h+10h\\\\\boxed{2g+4h}[/tex]

Hope this helps!

Answer Link

Otras preguntas

1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help
Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela
What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen
epistrophe literary definition
Why silk is called queen of fiber?
why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2
If o- can give to every other blood type, why cant it recieve other blood types
The process through which thoughts and actions become routine is ______.