robswifelorimay5452 robswifelorimay5452

02-03-2021
Mathematics

contestada

A kite string is 60 feet long and has a 42° angle of elevation. The boy holding the kite is 4.5 feet tall. How high above the ground is the kite?

Respuesta :

carloserovira12 carloserovira12

02-03-2021

Answer:

3.15

Step-by-step explanation:

this is the answer and no sad

Answer Link

Otras preguntas

a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place

when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar

How and where (at what latitudes) do atmospheric convection cells form?

Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

You are on standby at a sporting event when an infant nearby suddenly begins to cough

Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code is reported

The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat