cocomick38ri cocomick38ri

01-03-2021
Mathematics

contestada

I need help on this.. First person to answer this correctly gets a BRANLIST

I need help on this First person to answer this correctly gets a BRANLIST class=

Respuesta :

steeleflag19 steeleflag19

02-03-2021

Answer: The relation is a function.

Step-by-step explanation: Since there is one value of y for every value of x in (-2,4), (3,7), (0,8), (5,8), and (1,6), this relation is a function.

I hope this helps you out!

Answer Link

Otras preguntas

What is the name for the transfer of genetic information from one bacterium to another bacterium by a phage? select one: a. transduction b. translation c. penet

What contributed to social stratification that developed in the united states in the late 19th century?

The introduction of the Green Revolution in India was intended to

Toco el piano _______________ hace dos meses. desde se les por

PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!

If a family has three children, what is the probability that the family has at least one girl?

Marco is building a house. he bought lots of wood to make the frame of the house. he wants right angles for his corners. if he uses a piece of wood that is cut

Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to

why is derek miller's social media post different than most?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat