thegreatcatlord101 thegreatcatlord101

01-03-2021
English

contestada

I need to create an imaginary business for school, and it's going to be on selling pet food. What should the name be? Give me some suggestions! :D

Respuesta :

rynrynel rynrynel

01-03-2021

Beasty bites might be a good name

Answer Link

Otras preguntas

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The

Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?

A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what

Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420

Companies raise funds to expand their business by

Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5