aidanmillan34
aidanmillan34 aidanmillan34
  • 02-02-2021
  • Mathematics
contestada

Can someone please answer me

Can someone please answer me class=

Respuesta :

saintbellingan382
saintbellingan382 saintbellingan382
  • 03-02-2021

Answer:

%285×mt=√×¢≥π4726 answer this into the box +40pt =485 {487) _4727 284#

Answer Link

Otras preguntas

A guaranteed protection against vague laws is known as which of the following?
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Who was the u.s. general fired during the korean war for trying to create another world war with china?
What US policy was designed to handle the threat of communism spreading to the Middle East in the 1950s? A. The Kennan plan B. The Middle East doctrine C. Th
A box contains two red marbles, three green marbles, and three blue marbles. If we choose the marble, then another marble without putting the first one back in
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil
help quick please!! Thanks
Ully is having a party and wants to fill his swimming pool. if he only uses his hose it takes 2 hours more than if he only uses his neighbor's house. of houses
Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False