princesss22 princesss22
  • 01-02-2021
  • Mathematics
contestada

Amanda bought 4 pairs of jeans for $7140. How much
would she need to pay for 8 pairs of jeans?

Respuesta :

pearcejamie9 pearcejamie9
  • 01-02-2021

Answer:

$14,280

Step-by-step explanation:

4 Pairs is $7140

4 x 2 = $14,280

Times by 2 as you are doubling.

Answer Link

Otras preguntas

A substance has a mass of 50g and a volume of 2mL. What is the density? What is the formula you will use? What is the answer?
8Z What is the variable?
(3-2sqrt-18)-(2+3sqrt-8)​
The total $ amount of the goods and services produced in a country in a given year.
you are given a sheet of paper, some thread and bar magnet and is asked to find the poles of the magnet.write how you would go about finding the poles of the gi
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
help please!!! asap please!
Can someone please help
What is meant by a “culture of escape”?
5. What would be the consequence of an ecosystem that had no nitrogen-fixing bacteria? (1 point) O Nitrogen from decomposing animals would never be returned to