vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

The cuboid and the cube below are placed on the floor. The cuboid has a weight of 60N and the cube has a weight of 40N. Which exerts a greater pressure on the g
Explain the students mistake
How many boxes of fish can fit in the shipping box? Explain your answer, will give brainlest!
I think of a number and I add one and then I double it
Write an equation of the line that passes through (2,−3) and is perpendicular to the line y=−2x−3.
The number of apples in 15 pound boxes sold at a farm is normally distributed as shown below. Number of apples in a box What approximate percentage of boxes hav
What keyboard functions lets you delete words
who was the leader of russia during world war 2
how to say mom in spash
Which text in the passage suggests that it is a primary source?