le5ighanailey
le5ighanailey le5ighanailey
  • 02-10-2016
  • Chemistry
contestada

proteins are build inside these

Respuesta :

Beth1309
Beth1309 Beth1309
  • 02-10-2016
I think you're talking about Ribosomes?

This is the organelle responsible for protein synthesis.
Answer Link

Otras preguntas

If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
why is derek miller's social media post different than most?
You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
What is the distance between 407 squared and negative 68 squared
31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr
Why is it important for scientists to use blind tests?
HELP FAST!!!! Solve the compound inequality, showing your work. Name the solution set and then draw the graph of the solution set. x-3≤-7 or x-3≥1
Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle