browndylan945 browndylan945
  • 03-05-2020
  • Biology
contestada

name for all bacteria

Respuesta :

JoyMark
JoyMark JoyMark
  • 03-05-2020

Answer:

They are all called bacterium. Which is the scientific word for bacteria. This is just what all bacteria is called. But there are 5 types of bacteria.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how is an error within an EMR corrected
Which phrase states a principle that was part of president woodrow wilson's fourteen points?
Name a few important body functions that your nervous system controls on its own without you having to think about it much?
The _______ was Franklin Roosevelt's program designed to fight the Great Depression
Where did the majority of people t ravel from who were heading to make a new life out of the west?
If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?
What is the distance between 407 squared and negative 68 squared
which statement is true for a career as a graphic designer?
A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?