juanmannuel76 juanmannuel76

03-05-2020
Mathematics

contestada

Please answer both questions and round answer geometry circles will mark brainliest

Please answer both questions and round answer geometry circles will mark brainliest class=

Respuesta :

bella24810 bella24810

03-03-2021

Answer:

32

Step-by-step explanation:

Answer Link

Otras preguntas

2. Quiz scores The scores on Ms. Martin's statistics quiz had a mean of 12 and a standard deviation of 3. Ms. Martin wants to transform the scores to have a mea

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

12x > 3(5x – 2) – 15 I NEED A STEP BY STEP ANSWER

Giải giúp e với ạaaaaaaaaaaa

What interest rate is needed

A rectangle has a perimeter of 58 cm. Its length is 5 cm longer than its width. What are its dimension?

is 3 cubed is the same as 3x3x3

Find the value of 7+c when c=18.

Is this a complete sentence? Unfortunately, our quarterback fumbled the ball in the fourth quarter.

Briefly explain ONE difference between the women’s rights movement in the period 1848–1920 and the women’s rights movement in the period 1950–1980.