vanesman2002 vanesman2002

01-05-2020
Mathematics

contestada

Leah likes the number 400 but not 500. She likes 900 but not 999.
She likes 2,500 but not 600. Which of these numbers will she like?

Respuesta :

mauricejenning mauricejenning

04-05-2020

Answer:

Step-by-step explanation:

1,200

Answer Link

Otras preguntas

If you attended the us public high school the highest status crowds were probably the

An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos

One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Latin prefix opposite of mini-

Ashya wants to focus on the diagnosis and treatment of psychological disorders and other problematic patterns of behavior. what area of psychology should she wo

Name the five transport mechanisms of the cell:

14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.

A school bus has 22 rows of seats, and 4 students can be seated in each row. students have filled 19 rows of seats, abd 1/2 of the remaining seats. how many sea

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?