brittanyreimers brittanyreimers

01-02-2020
English

contestada

Cocos Island is actually the peek of an extinct volcano

which correction should be made?

Respuesta :

Midnightshadow090 Midnightshadow090

01-02-2020

Answer:

Coco's island is actually the peek of an extinct volcano.

I guess that was the answer you were looking for?

Explanation:

Answer Link

Otras preguntas

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged

if 2^x-4=4a^x-6 what is the value of a

x 2 • x 5 answer quick

Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

paul has a standard deck of cards. what is the probability he will choose a 2?

Find the number. Six times a number is 9 more than three times the number. The number is |___| What I’m thinking right now “6x=27”