laynie77garrett laynie77garrett
  • 02-11-2018
  • English
contestada

what role did Ann putnam play in the dancining in the forrest

Respuesta :

1235751 1235751
  • 02-11-2018
she played the catalyst
Answer Link
kendallknight80
kendallknight80 kendallknight80
  • 02-11-2018
The catalyst is the role she played
Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
What does hemostasis mean?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what are the 2 major types of cofactors?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
how do you say theatre in Spanish
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert